Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARO7
Systematic Name YPR060C
Alias HGS1, OSM2, TYR7
Strain S288c
Description Chorismate mutase; catalyzes the conversion of chorismate to prephenate to initiate the tyrosine/phenylalanine-specific branch of aromatic amino acid biosynthesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARO7 YPR060C
TCATCGTTATGTAAAATTGTACCACCCTGACCATTCCGATAACATTCAAATATTTAGCTC
AGAAAAGGTTACCAACAGTGATAGTAAATCACCGCTGCTGCTAACATCAAGCGAAAAACT
ACATAGATTTAAAGTCATCTCTCAAGCATATGATATTCTTTGTGACCCAAAGAAAAAGAT
CGTATATGACACAACGAGGCAAGGCTGGACCACATCGTATTCACCACGTTCTAACGTTAA
TACTGAAAATTACCAATATGCCGGCTCTTATGGCTACCACTCTAACGCGCAGTATGAATA
CTGGAACGCTGGGACTTGGGAAGACGCAAATAGCATGAAAAACGAAAGAATTCAAGAAAA
CATCAACCCATGGACCGTTATTGGCATAATTTGTGGCCTAGCTATATGCATCGAAGGGAC
TGCGTTGTTAGCCAAAATCCAGGAGTCTCTGAGCAAGGCCGAATTTACTCATGACGAAAG
TGGATTACATTTGATTCAGTCATACACGAATTATGGTCTTGATACTGACAAATTTTCCAG
ATTGAGGCGGTTCTTATGGTTTAGAACTTGGGGACTTTACAAGTCGAAAGAGGATTTAGA
TAGAGAAGCCAAGATCAATGAAGAAATGATACGCAAACTGAAAGCAGCTAAATGAAATCA
CCTATTGCGCCGCTCGCGGAATACAATTACTAAATTTTATATATATTCTTTAAAAATGCA
TCTATACATTCGTTTTTCCACGTATACCAAATTCGAAAAAAGTTGTTAAACCATCGTTTT
CACGTTTTTTAATTTTTTTTTGGTTCTCTTTTTTTTTTTTTTTCAATATCAACTTTTTTT
CAAACTTCGTGTTGCATTTCCTTTATCGTAAATTTTCAATGGATCTCTATAATCTTCGAA
GTTCGAAGAAAAGAAGAAAAAAAGTATTGAAAAGTTGAAACATCGATTCCGTTTTGCTAA
CAAATAGCACTCAGCATCCTGCATAAAATTGGTATAAGAT
Chr coordinates Chr XVI from 675631-674861
w3c xhtml validator w3c css validator