Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DIB1
Systematic Name YPR082C
Alias SNU16
Strain S288c
Description 17-kDa component of the U4/U6aU5 tri-snRNP, plays an essential role in pre-mRNA splicing, orthologue of hDIM1, the human U5-specific 15-kDa protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DIB1 YPR082C
TTCAGTTCGTTCTCATTATTAACCGTTTCGTGCTCGTTTTGCTCCTGTAAAAAATGCCAT
ATGGTCACTAATTCATGATCAATAAGCAAAAGTTTGGACCTAACAAAGATACCTGCAATC
TTCATCCTTAGACGGCGCAATCTCTTCATAGAGTAGATCCAACACTCTAATAACAGGGTC
ATCGAATTCTGCAAAAGCCTGTCAACCCTGTTGTCTTCTATTGTATTGGACATTATGAAA
TCTCTAATTTGGTCAATGTCCCTTGACAGCGACTCAAGTGCAAGGGAAGACTTCTCGCAT
TTTTTGATGCATTTTAAGCTTAAATCTTTATAAAAGCTATCGTCCAGATTACCATTATGA
TTATCATCATCATCGTCGCCGCTATCACCGGCGCTATTCTTATTTCCACCAGACGTTTCT
ACTTCAAATTGAATTAAGACACTCTTGTGAAGGGATCTGATATACCATGATTGGTGAATA
ACAAACTCTAGCTTGATAATATCCGCTAATATCTTAACTAGAGCATCGCATTTGTTCAAA
GTAGCTTTGGATAAATGCAAATCTTCCTCATCATTCAGCATAGATTTTCCCTCCACCTTG
CGTTTTTCTTCACTAATCATTGAAGTTATCCAGCTAGTGTTGCGATTACCATTGATATCA
GTATCTTCCTCGTCTGCAGAATCATTGAGACCAGCCCTATGAAATTTGCTAACGATGGGA
TCCTTATCCATATTTGACCTCGAATTTCCCGAATTGAGTCCCTTTAATTCATAGCCAGGC
TTTACTGTACCGTTTTCATCCATGCTATAGTAGTAAGTGTTCTCTCTGGAGGGTTTTTAA
CTGTTTCTTTGCTGTTGTACAGTTTACTGCGAGGAGATGACTCGTTGTATTTCTTTTGGG
CCAATGACCGCTTCGCAAAGTGGAAAAACAGAACTTACATACCAAATTCGATCATCGGAT
AGAAATAGTACGTAGAGAAAGAGTAAGAAGTCAAGTTTTG
Chr coordinates Chr XVI from 704656-704225
w3c xhtml validator w3c css validator