Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MEP3
Systematic Name YPR138C
Strain S288c
Description Ammonium permease of high capacity and low affinity; belongs to a ubiquitous family of cytoplasmic membrane proteins that transport only ammonium (NH4+); expression is under the nitrogen catabolite repression regulation ammonia permease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MEP3 YPR138C
CGCAATGGCCAAAACTAAAAAATTTGAATTGCAGACCATCCAAATCAAAACTAATAAAAC
TGCCATCACCACATTGCCCATCTCCAATATGGAGTATTTATCTAGATTTCTGAACAAGGG
CATTAATGTTAAATGCAAGATCAACGAGCCACAAGTACTCTCGGATAATTTAGAGGAATT
ACGCGTTGCATTAAACGGTGGCGACAAATATAAACTAGTCTCACGGAAGTTAGATGTTGA
ATCTAAGAGGAATTTTGTGAAGGAATATATCAGCGATCAACGTAAAAAGAGGAAGTAGAA
ATACTTATGAAGGCATGCATGCATGCATACATATTTATATATATATGTCTTTAGGAGTAT
GTATTGCATTTAATCGAAACAAACAAGAAAAAGAAGAGTAGATGTGCCCGTTTCTGTCAC
TCCTATTTACTGACACTTTCTTGACCTACCTCAAACCAGTTCCAGTTCCGGCAAAAAGTG
CCGCGCGGCGGAGAAACATCTCCACCTTATCTCGGCGCCAAATCCTTATCTCTCGTAGCT
GGTTTGCCCGCGATAAGGCGGGCGAGTTATTTTGAAGTTTTCCATAAACTGGTTTTCCAT
CTCGAGGTTTTTCCTCGCTTTCCACGCTATGACCCTTTTTAGTTAAGGTACCCGATGGCA
TACTTTATATATTATATATATATGTTAAGTTAATATGTTTTAGCAGATTTGATATGCTGA
TATGCAGCACGGACTTTCCCTCTCCTTGTCTTATCGCATCTTATCGCAACAATTTGATAG
ATATCTTCTCCCTTTCCTATCTTGTAGAATAAGGTTGTGTGCTTTGAGTCTGATAGCCGT
CTTCTTTCGGTCGCTTCTTCTCTCTTTTGGTTCTTTGATTGTCTATTACAATCAATGCAG
GCTAGTTAAGGGTCCAATCACTTTTGAAATTGTTTTGTAAAAAGCGAAGGCATTTTTTTT
TTAGAAGATACAATTGAAAACATATAGATTTAGAGTTCAC
Chr coordinates Chr XVI from 812453-810984
w3c xhtml validator w3c css validator