Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ASN1
Systematic Name YPR145W
Strain S288c
Description Asparagine synthetase, isozyme of Asn2p; catalyzes the synthesis of L-asparagine from L-aspartate in the asparagine biosynthetic pathway
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASN1 YPR145W
TTTTTCTTTTTTTTCGATTTTCATTTAACAGGTATAAAAAGCGAAACACTCGGTACATAT
ATTTTACCAAGACGCGTTAGATTTTCTTTGGAGGTTTCATTTAAAGAAACCAATGACCTT
CCAAGTTTTTAAAAGAATACGATGATATTATTTGCGTTTCAAATCGAACAATTCTTCTCG
GAGCGATCTGAGGTTTTAATGGAGATAGCGGTTCCTGCGCAACCCATTGATCTTGTTACA
TTCTTAAGAATGACAAGGACGCTTTTATAAAATTCTGATTCTTTTTTCTTTCATTCTTTT
GTTGTTTTTGACTTGGGAGTAGTCATCTCATCTGTACACAAGTAGCTTTTTATATGTTCT
TAAATTGTAGACTAGTCAAAACTTGTGTCCTTTAAACCGTGCCGAAACAGTTTTAAAGCG
GACATCCAGGGAAACTTGCCGTTAACAATAAGTGACCTTGCATGGAAGACTGTCGATTGG
TCTCTGTGGAAACCAGTGCATATCTAAATTAAATCTATTGTCATCACGAATGCCGCCCGT
GTTCGTGCAACGTGAGCGCAAATACGCCTGGGGTCTGTCTTTCTGCGCTGGAAAGCACCT
TCGGGCATCAACTACCGTTTCTTATCGCTGGCACTATCTATCCACCAATCACACGGCAGC
AGTACTGCTGCCGTGGACGGCAAATTAGGTACAGGGCCTATGACTGTTATCATTTGGCAG
GCTCAGACAGAGAGAGAGAGCACAAGGAAAAGAGCCTTAACTCATGTAACATTTGACTCA
TTCTGTAAACTGAAAATTTGCTGCCCACTCGAGATGACAAATAGTTCGTTCTTGAATTTA
TGCGCATTTATAGATACGCATATATAACCCTATAGTGAACGCCACTAGGAGACAGATTCT
GTTTGGACCCTGATCGCATACTCTTCTTACCTTTACATAATAAAATAAGAAAAAGTATAA
CTTGCTTTACGCTAAGGATATAAATCGGACGTAACTTAAG
Chr coordinates Chr XVI from 822620-824338
w3c xhtml validator w3c css validator