Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MAY24
Systematic Name YPR153W
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MAY24 YPR153W
TCACGAACTGTGTCATCTCTGATCTTGTAAAAATCAGGATCGTTTTCGATTTTCTTGCTT
TGCAGCGACCACGTGGAAAACTTGTCTAGTTTATACCTATCGAATAATTCGAAGAAGATA
TTACGCTCGTCAATGTCATCTGTATCAATACGATTCAGATCATCGATAATGCTGATATCT
TGATTTACAATTTGTTCTTCATTCTCTTCGTCTTCCTCTTCGTCTTCCTCTTCGTCTTCC
TCCCCCGAAGATGAACCATACCCGCTGACTAGCCCAGTGTGGCTTTCCTGTAAAGGGGAT
TTTACGTCACCCGCCTCTTCGCTGATCTCATCTTTTCTCTCAACTTCGTCTTGATTTCTT
TTAAATAGATGAATCTCTTCGTTGCAAGATTCGAGGATTTTATCAATGTCCTCCTCCCGC
ATAGTGTAACCTCTGGCAACGCCAATCAGAAGAACCAGTTTTTCCTTATCTAACGACTCG
ATTAATGAGCGACACCTGCTGTCGTCCTCTTGACTGATGTCATTTTTGAACTCCTTAGAG
TCATCATTAAAGTAAAGTTTTGTACCATCGTTGTATATTATTAAGTGCCAACCATTAACC
AGTTCTAATGAAAATGTTGGCTTCCTCTCTGTCTGTGATTCTTTCGCATTGCTTTCTAGG
TTAGAGCCTTTCTTCAAATTAGGTTTTTCCCATCGAGACTGCTTCGTGTTCTTATTATAG
TAATACTTTTTGCCTGCAGGTGTCTTAAATTCCTGCCATTCTCCACGCATGGCGATTCTG
TGTTACTGAACTGTCTTTCTCTTTATAATACATATCAGAATCTCTTTCGGACACTATTTC
CTCTTTCTTCAATTATATTGTTTTCTCTTTCATTGCCGAAGAAAAAAAGAAACATACTGA
AAGTTGATAAATATGCAATAATAAAACCTTTTCCTACTCTTGACGCTTCTGTATAAGATA
AAAACTGCCAACAAGATCAGTTCCAACTTCCTGCCGTATT
Chr coordinates Chr XVI from 833689-833693,833828-834245
w3c xhtml validator w3c css validator