Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CUR1
Systematic Name YPR158W
Strain S288c
Description Protein of unknown function involved in destabilization of [URE3] prions; similar in sequence to Btn2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CUR1 YPR158W
GGTAAAACTGTGACACCCTCCTCAGAGAGAGAAGAATCTCTCGGTTTGGATTGGTTGCAT
TTTCAAGGTGGATGGGGTGATCAACAACTACCAGCTAGAGATCCAAGACAGAAATGGTGC
GTAGCTCAATGGAAGTATATCGGAGGTCCTCGTGGCCCCCTGTTTAAGAAATTGGATAGA
TTGAATCTATGCGGCGGTGTGAAAAAGTGGAATTTCTGGAATGGTGGCTGCCCCGCAAGA
AGATTGATAAAAAAAGCAGAAGGCTTGGACTCTGAGAGCACTGATCTTATGGGTGATAAT
TGTGGTGTCCTACTCTATAGAATCAGACCAAAATGGCTGAGAGGAATTCTAAGATTTCTA
ATGTGGAGAGGTATACTCTGTTCTCTTATGGAATTTTTCACCAATTGAAGAACTTTATGA
CAACAGAATGTTCTGATTGTAATATAATGACAAATTTTAATCTTTAGTAATATCTAATAT
AATAGTTAATGATAAATAGTTAATTCTAATGTTTAATGATCTGCAAATACTTTTTATGTT
TTTCAACATAGTTTTTAATGTGTTTCTACACTTGATCGCAACTAAATCTAAATAAACACA
CAAGCACAAAATATGATAAAAAAGCAATTTGGCTAGAAGCACAGGAACCAAATATGACGT
TCAATTCAAATAGACCCTTATTTCTGGTCTTGTTCATCAGTCCCTGATGTCTTGCTCTTT
CCTTCTGCAATTGATAGCGCCACACTTCTCAAAAGCAGTGGAAAAAAAAATCATTTCCCA
GAAGAACGCGAGAGAACTCCATAGAAAAAAGGGAACTTTCCTACTCAAAAGAGAAAGGGA
AAAATAATTGCGATATATCTTATAGCCTTTTTTTTTTTCCAACTTTCTATTTTTGTAAAA
ATGAAAATTTCCTTCATAAGCTACAATAAGACTACTCCATCCCTTGTTTCCTCAACGCAC
CGAACTCGATAGGACTGGTCGTAAAACAGAAAACTGACTA
Chr coordinates Chr XVI from 843262-844020
w3c xhtml validator w3c css validator