Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CUR1
Systematic Name YPR158W
Strain S288c
Description Sorting factor, central regulator of spatial protein quality control; physically and functionally interacts with chaperones to promote sorting and deposition of misfolded proteins into cytosolic compartments; involved in destabilization of [URE3] prions; CUR1 has a paralog, BTN2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>CUR1 YPR158W
ATGGCTGCCGCATGCATTTGTCAACCTAATCTTCTTGAGATTAATGTATCTGATGGACCA
CTGGATATGATCCGCAAGAAAAGAAAAATACAACAGCCGCAACTACGTCCACCCCTTCGA
GAGAATAAATGCCAACCACACTTTTCTGTACGAAAGGTAAACCAGTCTTACATAATTTCT
CTCCATAAAGAAATCACATGCCAACTCATTGCAGAAATTGTCAAACAAAAGTTATCGAGG
ATTTGGGAAAAAGTATACATACCATCTTATGAACTGATATCAGACAAAGACGGTAATCAA
ATTTATGTGGAACAGAGTGTCGACGAAAATAGGCTAACTTCTGAGATTATGGAGAAACTG
GACCCCAACAATATTGATATAGAGGCGATCGAAATATTATTCGACGACTATCACCTAGAA
TTATCACGCTTGACAAACGGTATTATTATATCTAGTGCCAATGATCACTTTTACAGGGAA
TTCTCCTTCAATAACATAATTGATGACAACTTTAAAATTTGTGGAACAAGCATGTCTGCA
GACAGTTTTGATAAGATTTATGGCGTTATGTGGATTGAAGTACCTTTCAATGGCAATGGC
TTACAGAATGATAGCGCCGTTAATAGGGTTTCAACATCTCACAATCAGATAGAAGAATTG
AATGACATAGAGCAGGAGATAAGAGCTTTTAATATTAGTCGAAGTAATCAAGAAAGTATC
ATCAAAAAGGAAGTATCTAGAAGATTGAATGGGCGGTAA
Promoter Sequence
Download FASTA
>CUR1 YPR158W
GGTAAAACTGTGACACCCTCCTCAGAGAGAGAAGAATCTCTCGGTTTGGATTGGTTGCAT
TTTCAAGGTGGATGGGGTGATCAACAACTACCAGCTAGAGATCCAAGACAGAAATGGTGC
GTAGCTCAATGGAAGTATATCGGAGGTCCTCGTGGCCCCCTGTTTAAGAAATTGGATAGA
TTGAATCTATGCGGCGGTGTGAAAAAGTGGAATTTCTGGAATGGTGGCTGCCCCGCAAGA
AGATTGATAAAAAAAGCAGAAGGCTTGGACTCTGAGAGCACTGATCTTATGGGTGATAAT
TGTGGTGTCCTACTCTATAGAATCAGACCAAAATGGCTGAGAGGAATTCTAAGATTTCTA
ATGTGGAGAGGTATACTCTGTTCTCTTATGGAATTTTTCACCAATTGAAGAACTTTATGA
CAACAGAATGTTCTGATTGTAATATAATGACAAATTTTAATCTTTAGTAATATCTAATAT
AATAGTTAATGATAAATAGTTAATTCTAATGTTTAATGATCTGCAAATACTTTTTATGTT
TTTCAACATAGTTTTTAATGTGTTTCTACACTTGATCGCAACTAAATCTAAATAAACACA
CAAGCACAAAATATGATAAAAAAGCAATTTGGCTAGAAGCACAGGAACCAAATATGACGT
TCAATTCAAATAGACCCTTATTTCTGGTCTTGTTCATCAGTCCCTGATGTCTTGCTCTTT
CCTTCTGCAATTGATAGCGCCACACTTCTCAAAAGCAGTGGAAAAAAAAATCATTTCCCA
GAAGAACGCGAGAGAACTCCATAGAAAAAAGGGAACTTTCCTACTCAAAAGAGAAAGGGA
AAAATAATTGCGATATATCTTATAGCCTTTTTTTTTTTCCAACTTTCTATTTTTGTAAAA
ATGAAAATTTCCTTCATAAGCTACAATAAGACTACTCCATCCCTTGTTTCCTCAACGCAC
CGAACTCGATAGGACTGGTCGTAAAACAGAAAACTGACTA
Chr coordinates Chr XVI from 843262-844020
w3c xhtml validator w3c css validator