Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NUT2
Systematic Name YPR168W
Alias MED10
Strain S288c
Description Subunit of the RNA polymerase II mediator complex; associates with core polymerase subunits to form the RNA polymerase II holoenzyme; required for transcriptional activation and has a role in basal transcription
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NUT2 YPR168W
GGATTTATTTTTAAGATTCCATTAAGTTCGTCTATTTCAATAATCGACAGTTGGGAGCGG
GCAGAACCTTGTGATTTTCTTCTACCAGTAAACACAGCACTTATATGTAGCTCTTTGTAG
GCACGATGTGCAGGTTCCACTTTGGCCAGATAATCGTACTTGTCATCATCTTTCTCCCAT
AAGAAATCCCCGTATTTCGAGGCAAAATCTGCCTCCGATTCACATCCATCCGGCTTATAT
ACGTGAATGGTTTGATTTTTAGGCTGGTAGTATTTTTTCTCAATCTCGTTTTTTAGTGTT
AAAGTTTGTGGGAAATGGTGCAAAGTGTCTATAAATAATAGTTCTGGCATGTAGTATTTT
TCAGATAGCTTTGACAACATATCGATAGTAACCAAGCCAGTCAAACCAAATGCAGTGGTT
TGGAAAAGGTGAGGAAACGTTACGATAGACCATGCAATAATCTCCTGTGGCGTTTCCAGC
TTGATTAGTTGTTCATTCCAATGATCCAACTGTTCTTGTGTGACAATTATATCATTATTC
AAATGATAGGTCTTCATTTTATGAGTTGCTATGGGTTGATACCTTTGCTGGCCTTAGTTT
TGATCTTAAAGCATTGAAAAGGTTACAAACAGTACAGTATACTTTTTTTATATCAATATA
ATACTATCTCTATGAGCTTTTACTTTGTCGAGATTTGCTGAGTCATGTTGTGGCTTTTCT
TTTACTAGCCACGTGAAATGATGATAAAAATAAAAAGAATAACGACGGAATAAAGAACAG
TATGATAAACCGTAAAGATATTTAGAATCAATAGGTGATGTCCACCCGGTAACAAGATGC
CATTCATGTTAAACTAGGACAAATTTCCTTCTTGTCCCCCCACCATTCTCTTTTATCCAA
TTCTTTTGTCAGCGCGCATTAAAGAACAAGAACTTCGTACTTTTAACTACTAACTCCTGT
TTGAGAAAGAGGCAAATATATAGAAAAATAAACCGATAAG
Chr coordinates Chr XVI from 878076-878549
w3c xhtml validator w3c css validator