Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GDB1
Systematic Name YPR184W
Strain S288c
Description Glycogen debranching enzyme containing glucanotranferase and alpha-1,6-amyloglucosidase activities, required for glycogen degradation; phosphorylated in mitochondria; activity is inhibited by Igd1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GDB1 YPR184W
ACCTACAACACCCTCCAGAGACCGTGCCCAAGTTGTTCGAGTCTTTGCACGATCACGCCT
TTACTCTGGGCACCAGATATGCCCCAGGTGTCGGCATTGACAAGGACTGGCCTATGTACA
GACGCGTCATTTCCTCCACTGCTAGAATGATGGCCAGACCTTTGACCATCGCCTCCGACC
CCATGAGCGGGTTCTTCGGTCTACAAAAGAAGTACCTCGAAAACTGCAACCCTAGGGACA
TCAACTCGCAAGGTTTCAAGATTGCCCTCGAGCTTCTCGCCAAGCTTCCTCTTCCAAGAG
ACCCTAGAGTGGCGATCGGCGAAGTGCCATTCACTTTCGGCGTGAGAACGGAAGGTGAAT
CCAAACTGTCAGGTAAAGTCATTATCCAATACTTGCAACAACTTAAGGAGCTCTACGTCT
TCAAGTTTGGCGCCAATAACCTTATCCTTTTCATTACTTTCTGGTCCATTCTGTTCTTCT
ACGTTTGCTACCAGCTATACCATTTGGTCTTTTAAAGGAAGTGAATGGTAACGAAAAAAA
AAAATCTTTCTTTATATGTCTCTTTAAGTACTCCCTTTCAGTTATATGCCTTTTATTGTC
TGTCCCTATTCTAATCCTCTACTCGGGCCATCATTGTTAACGTAATATTTGCCCTAGGGT
AAAAACATTAGGTTGATTAGGCCATAACTCATTCTGCCCCACCCCCACACATAGGGTTCA
GGAACTTGGTTTTCAACCCTACTGCATTGTTTCCCACGCGGCGCTACCAAAATATATCCA
ATTTTCTTTTTTGTCACAACAGCAGCAACCCCTTGAAATGGCCAATTCTTCTCGAGACTT
TGCTCCCTTAATCTTTTCTTCCCCCCCGGTTTCTTGATGATTATATATACTAACCTCGTA
TATTACACACTGTACTTGAAGTCACTCATATCCGAATACTACTTCTCTTAACTTCCAGTC
AACCCGACACCCACAATCGTCCTTAGTATATAACTGCTTT
Chr coordinates Chr XVI from 902044-906654
w3c xhtml validator w3c css validator