Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name OPT2
Systematic Name YPR194C
Strain S288c
Description Oligopeptide transporter; member of the OPT family, with potential orthologs in S. pombe and C. albicans; also plays a role in formation of mature vacuoles
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>OPT2 YPR194C
CGCGTTTTTCCTATTTGGGTACGGAGATATTTATGTTTTGATAAGCAAATGCTTCAATTG
TGCCGTGCGCATCATCAATCCCACTCACTGAGGAACTCTATAATGAAAAAAAAACAAACA
GGCAAAAGCAGATAGACCAATAATTGATATCTGATTTTTCACAAAAAATGCAGGAGAGAT
CAGCATTAAACGGATCCATCACATCCACCGGACGAATCCGTCTCAAATATGGCAGCCACG
CTGGTGTGACACATAATATTACTGCAACACTTCTTATCTCATTATTTTTATCATGGTAAA
AGAAGTCAACACTATGCGAGGAATACCAAAAGAAAATTTGGTTCACATCATGGTGTCAGT
AAAAGCAACCGACAAAAATCGGGGGGTTGCTGTCCGACGTAGTTTCTTCGTTATAATTTT
CAATAATCCCACATTTCGTTGTTAACCTTTTGCAAAAATTGATGTAGTTTGTTTTCCTCT
TGGCCCCTGTTGTGGTTACCGAACACGTGAATCGCCATTGCGGTTGTCAATATCAGCCCA
TTGGGTTTTATGAAGATTCGTAACACCTTCGATTATTTAAGTTTATTCTCTTATCTACAA
TAATAATAGCGTTCTTTTACAATTGGACGCTGTTATCTTACTTCTGAATGTTCATGGATT
GGAAATTTTCAATCATTTCACGAATTATTAGCAATGAAGATAAGTAACATTAAAAAAAAT
ATTGATATCAACTTGCTAGGTTTCTTCTCGCTTCAAAAAAATTTATAAATGGGAATGGAA
CACTATCCTGTGTAAACTTAAGTCATGTCTCAAGTCAGTTGTTACTTATATTCATTCCTA
TCGAAACATCCCAAAAAATAATATTTGAAACACTTACAATCATACATTGAACGTCTAAAC
AACGGCGGCATTTTTTTAATAGCAGAAACGAACATATTAGCTTATTCTACAACTAGTAGG
GTTTGTTATACGCAATATTGCTGTTGAATTATTAGAAATT
Chr coordinates Chr XVI from 926937-924304
w3c xhtml validator w3c css validator