Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name tL(CAA)G1
Systematic Name tL(CAA)G1
Strain S288c
Description Leucine tRNA (tRNA-Leu), predicted by tRNAscan-SE analysis
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>tL(CAA)G1 tL(CAA)G1 Chr VII from 205527-205640
GGTTGTTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGCAATATCTTGACCGCAGTTAAC
TGTGGGAATACTCAGGTATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCA
Promoter Sequence
Download FASTA
>TL(CAA)G1_TL(CAA)G1	tL(CAA)G1 upstream sequence, from -1000 to -1, size 1000
TGTATGGAAATTTTCGAGACTCCATTTTTGGACGAAAGCAATGAAAATTATATACAGAAT
ATTCCAGAAGATCACCTCAAAAATCCAAAAATATGATCAGTGATTTAACAAGAAAACCGA
AGATTTCTATTGTTCCTTCGAAATTTTTTCAGTTTTATGTTCAATCTCTATGTTTTTCTT
AAAATGATAAAAGGTCGTCCAGCTTGGTGAAGCTTACATTTAAATTAAATAAATTGGTGT
GACTGAATAGAATAGCGTCCTTAATAACTAGAGATTACATTGTAGATGAATAACAACTAA
TTAATTCAAAAAAAGTAATCGTTAACTATTTCCGGAAGAAACAAAGGCTCATTATCAAAT
TTGATGATCACAACCAATGTGTATTTAAATAAAGGCCAATATCTCACGGTCTGTTGAATC
TAAACTAACTATTGAAATATTCATTTGTTCAGAAAAAAAGATCATTAATATTACATGTAC
TGATATGCTAACAATCCAAAAATGCTTATACTACATATTGTTGTACACCATGGGTACCGT
TAAATGACAGTGTAAACAATTGCAGAAGGAAATGTTACACTAGCGGTTAAACAATACTGA
ATTAAAGATTTTTTAGTTGAATATGATATGACAGTTATATACGTGAGCAATATAAGTCCC
CACATTGAGTGTATGATAACTACCGGAATTACTATCATATTGTTCGTAAGCAATAATAAA
TCAATTAGTGTGGGTGTTTTATACCTCTCTCATATGAGTATATAAAGATCCTTATTTAAT
TTTGATTATACTATCTTCTAGCCTTCAATTATCGACATCGCTCACTTGAGCAGTTCATCT
AAGAAAAAAAGAACTATAGCTAAATAACCCAGTATTATTTGTTTCGCTGTAGGTTGTTGC
ACAAGGGTTTCTTCTGTGAACATTTTGAATTGTACGCTTAAGATGATAATACCTAACTGA
TTCCAACCTATATTAGTAGAACCGAAACATACAAATAAGT
Chr coordinates
w3c xhtml validator w3c css validator