Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Search by DNA motif > Result > View in Promoter Contact/Credits     Tutorial     Help

 

View Consensus in Promoter

Warning! Overlapping consensus sequences found in either strands may not be highlighted correctly!
Standard Name MET13
Promoter Sequence

Consensus
CACGTK: -821 -603 -522
>MET13    upstream sequence, from -1000 to -1, size 1000
TCCAGGGCGCCCTGCAGGCGACGCAACCGAAAACCCCAAAAAACGTAACGGCCAGCGCTG
CCGCTGCCATCAATACTTTTATTCATGACCAGATGCACAGGTGGCAAGGTCCGTTAACCA
CCTCGGCACAGTGCAGACGTTTTGGAGGCCATTGGGCTGGAGGACACGATCCATCCGGGC
ACGTG
TTCTTGGCCACCTTGATGTGCATGTTTCTTCTAGGTGAGCTACGTGTGTTTGGGC
GTCGTGCACTGGCTCACTTGTACGCGCAGAAATGGCAGCTTGTACGATTGGTGACCCGCC
TTTTCGACACTGGACCGCTATGGACGTGGCGGCGGTGTGGCGGCGGCTCAATGACCTGTG
GCGCCCGTTTGTGGCGTGCGATAGTCGAGCCGCCTGTCACGTGCGCGGCCGCCCTGCTCC
GTTTGACGCGATGCATAGCATGCGACCACCCAGTAATCATACTGCTGACGCTATTGGTCA
CGTG
GTTATGGCAGCTGCTGTTGACTGCGGTGGCGTCCCGTTTCCACACCGTACGTGAGC
ACATGTCTGGATTGCTAGCTGCGTACATAGTGACAGGCCTTGTCTACGCTCGCGACGCAG
CCGCGCTACGTCCAGTATGACTCAGGAAAAGTTGGCGATAGACCACGAGCGACTGAAAAA
ATAACAGCGACTTTTCTCCCGGTAGCGGGCCGTCGTTTAGTCATTCTATCCCTCGGATTA
TAGACTGTGAATATTGCATATGCAACTTTGACTCAAATTTTTCCAAAATTTGATATATAT
ATATATATATATATGTTTGTATGTATATATATATATACGTATATATATCATATATACGAA
AAGTAGAAAAAAAAAGGTGATATTTCGCTCGTGGAAAAGCTAATGCCACAGCTTGTGTTT
CGTGTAGTTTGCCTTGCTCCCCTTGATTGAAATAGTCTCCCTAAACTAAAGTTATCAGCA
AACAGAACCACCACAGTTACTACTACAACCACATCGCAAT
Promoter Sequence
Complementary Strand

Consensus
CACGTK: -516 -597 -815
>MET13	Upstream Sequence Complementary Strand
AGGTCCCGCGGGACGTCCGCTGCGTTGGCTTTTGGGGTTTTTTGCATTGCCGGTCGCGAC
GGCGACGGTAGTTATGAAAATAAGTACTGGTCTACGTGTCCACCGTTCCAGGCAATTGGT
GGAGCCGTGTCACGTCTGCAAAACCTCCGGTAACCCGACCTCCTGTGCTAGGTAGGCCCG
TGCAC
AAGAACCGGTGGAACTACACGTACAAAGAAGATCCACTCGATGCACACAAACCCG
CAGCACGTGACCGAGTGAACATGCGCGTCTTTACCGTCGAACATGCTAACCACTGGGCGG
AAAAGCTGTGACCTGGCGATACCTGCACCGCCGCCACACCGCCGCCGAGTTACTGGACAC
CGCGGGCAAACACCGCACGCTATCAGCTCGGCGGACAGTGCACGCGCCGGCGGGACGAGG
CAAACTGCGCTACGTATCGTACGCTGGTGGGTCATTAGTATGACGACTGCGATAACCAGT
GCAC
CAATACCGTCGACGACAACTGACGCCACCGCAGGGCAAAGGTGTGGCATGCACTCG
TGTACAGACCTAACGATCGACGCATGTATCACTGTCCGGAACAGATGCGAGCGCTGCGTC
GGCGCGATGCAGGTCATACTGAGTCCTTTTCAACCGCTATCTGGTGCTCGCTGACTTTTT
TATTGTCGCTGAAAAGAGGGCCATCGCCCGGCAGCAAATCAGTAAGATAGGGAGCCTAAT
ATCTGACACTTATAACGTATACGTTGAAACTGAGTTTAAAAAGGTTTTAAACTATATATA
TATATATATATATACAAACATACATATATATATATATGCATATATATAGTATATATGCTT
TTCATCTTTTTTTTTCCACTATAAAGCGAGCACCTTTTCGATTACGGTGTCGAACACAAA
GCACATCAAACGGAACGAGGGGAACTAACTTTATCAGAGGGATTTGATTTCAATAGTCGT
TTGTCTTGGTGGTGTCAATGATGATGTTGGTGTAGCGTTA
w3c xhtml validator w3c css validator